Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1059273
End position: 1059296
Length: 24

DNA sequence
>NC_010524, from 1059273 to 1059296 (24 bp); Leptothrix cholodnii SP-6 CTGCAGCAGCAGCGGCAGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1058605-1059642	Sequence	Lcho_0990 - inner-membrane translocator (Protein is coded in complementary strand; from 1059642 to 1058605)