Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 932676
End position: 932717
Length: 42

DNA sequence
>NC_010519, from 932676 to 932717 (42 bp); Haemophilus somnus 2336 TGGTCATGGTCATGGTCATGGTCATGGTCATGGTCATGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 931926-933092	Sequence	HSM_0813 znuA high-affinity zinc transporter periplasmic protein (Protein is coded in complementary strand; from 933092 to 931926)