Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 594208
End position: 594232
Length: 25

DNA sequence
>NC_010519, from 594208 to 594232 (25 bp); Haemophilus somnus 2336 AAAGGAAAGAATAGGAAAAGAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 593164-594222	Sequence	HSM_0515 - DNA polymerase III subunit delta'
ORF... 594231-595013	Sequence	HSM_0516 - TatD family hydrolase