Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 410077
End position: 410112
Length: 36

DNA sequence
>NC_010519, from 410077 to 410112 (36 bp); Haemophilus somnus 2336 CCAAAAATATCGCCGAACATATCGCCGAAAATATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 409267-410388	Sequence	HSM_0367 - chaperone protein DnaJ (Protein is coded in complementary strand; from 410388 to 409267)