Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 380112
End position: 380135
Length: 24

DNA sequence
>NC_010519, from 380112 to 380135 (24 bp); Haemophilus somnus 2336 GTGGTTGCGGTTGAGGTTGTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 378185-382837	Sequence	HSM_0346 - YadA domain-containing protein (Protein is coded in complementary strand; from 382837 to 378185)