Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 202932
End position: 202959
Length: 28

DNA sequence
>NC_010519, from 202932 to 202959 (28 bp); Haemophilus somnus 2336 CTTTTTCCTTTTTCATTTTTCATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 202952-204856	Sequence	HSM_0193 - peptidoglycan glycosyltransferase (Protein is coded in complementary strand; from 204856 to 202952)