Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 1914847
End position: 1914870
Length: 24

DNA sequence
>NC_010519, from 1914847 to 1914870 (24 bp); Haemophilus somnus 2336 TGTCTGTCTGTCTGTCTGTCTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1914598-1918695	Sequence	HSM_1666 - type III restriction protein res subunit (Protein is coded in complementary strand; from 1918695 to 1914598)