Sequence retrieval

Genome: Haemophilus somnus 2336
Start position: 1264177
End position: 1264212
Length: 36

DNA sequence
>NC_010519, from 1264177 to 1264212 (36 bp); Haemophilus somnus 2336 CTTCGGTTTTTCCTTCGGCTTATCTTTCGGTTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1263740-1264492	Sequence	HSM_1100 - TonB family protein (Protein is coded in complementary strand; from 1264492 to 1263740)