Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 2599991
End position: 2600035
Length: 45

DNA sequence
>NC_010468, from 2599991 to 2600035 (45 bp); Escherichia coli ATCC 8739 GCCACCACCGCCTCCGCCACCCGCGCCGCCGCCAGCACCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2599986-2601881	Sequence	EcolC_2360 - hypothetical protein (Protein is coded in complementary strand; from 2601881 to 2599986)