Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 4224408
End position: 4224443
Length: 36

DNA sequence
>NC_010468, from 4224408 to 4224443 (36 bp); Escherichia coli ATCC 8739 CATGCCGCCCATGCCACCCATGCCGCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4224403-4226049	Sequence	EcolC_3869 groEL chaperonin GroEL (Protein is coded in complementary strand; from 4226049 to 4224403)