Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 1902511
End position: 1902538
Length: 28

DNA sequence
>NC_010468, from 1902511 to 1902538 (28 bp); Escherichia coli ATCC 8739 ACCAGCAACCAGCGACCGGCAGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1902232-1903890	Sequence	EcolC_1704 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 1903890 to 1902232)