Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 4023387
End position: 4023413
Length: 27

DNA sequence
>NC_010468, from 4023387 to 4023413 (27 bp); Escherichia coli ATCC 8739 GCCGCTTTCACCGCTTTCGCCGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4023324-4024646	Sequence	EcolC_3674 deoA thymidine phosphorylase (Protein is coded in complementary strand; from 4024646 to 4023324)