Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 1175412
End position: 1175438
Length: 27

DNA sequence
>NC_010468, from 1175412 to 1175438 (27 bp); Escherichia coli ATCC 8739 CTTCTTCAACTTCTTCAACTTCTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1175408-1175758	Sequence	EcolC_1085 - translation inhibitor protein RaiA (Protein is coded in complementary strand; from 1175758 to 1175408)