Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 977922
End position: 977945
Length: 24

DNA sequence
>NC_010468, from 977922 to 977945 (24 bp); Escherichia coli ATCC 8739 AACACAACAACACAACATCACAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
977863-978009	Sequence	EcolC_R0022 - (Protein is coded in complementary strand; from 978009 to 977863)