Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 4643601
End position: 4643624
Length: 24

DNA sequence
>NC_010468, from 4643601 to 4643624 (24 bp); Escherichia coli ATCC 8739 ACCTGCACCTGCACCTGCACCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4642475-4643668	Sequence	EcolC_4204 - putative uroporphyrinogen III C-methyltransferase