Sequence retrieval

Genome: Escherichia coli ATCC 8739
Start position: 286316
End position: 286339
Length: 24

DNA sequence
>NC_010468, from 286316 to 286339 (24 bp); Escherichia coli ATCC 8739 TAACGCGCTAACGCCCTGACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284811-287009	Sequence	EcolC_0247 zntA zinc/cadmium/mercury/lead-transporting ATPase (Protein is coded in complementary strand; from 287009 to 284811)