Sequence retrieval

Genome: Acinetobacter baumannii SDF
Start position: 605189
End position: 605218
Length: 30

DNA sequence
>NC_010400, from 605189 to 605218 (30 bp); Acinetobacter baumannii SDF CCTAAACCTAAACCTAAACCTAAACCTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 604688-607276	Sequence	ABSDF0657 - bifunctional sulfite reductase flavoprotein alpha-component/iron-uptake factor (Protein is coded in complementary strand; from 607276 to 604688)