Sequence retrieval

Genome: Acinetobacter baumannii SDF
Start position: 2032293
End position: 2032328
Length: 36

DNA sequence
>NC_010400, from 2032293 to 2032328 (36 bp); Acinetobacter baumannii SDF AGGTTCAGGTTCAGGTTCAGGTTCAGGTTCAGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2031511-2033559	Sequence	ABSDF2208 dnaX DNA polymerase III subunits tau and gamma (Protein is coded in complementary strand; from 2033559 to 2031511)