Sequence retrieval

Genome: Acinetobacter baumannii SDF
Start position: 1532143
End position: 1532196
Length: 54

DNA sequence
>NC_010400, from 1532143 to 1532196 (54 bp); Acinetobacter baumannii SDF GGTGGTCAAGGTGGCTTCGGTGGTCAAGGTGGCTTCGGTGGTCAAGGTGGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1531817-1532326	Sequence	ABSDF1625 hfq host factor I for bacteriophage Q beta replication, a growth-like protein