Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 987667
End position: 987690
Length: 24

DNA sequence
>NC_010364, from 987667 to 987690 (24 bp); Halobacterium salinarum R1 CGTTGTCGTTGGCGGTGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 987384-988829	Sequence	OE2907R phr2 deoxyribodipyrimidine photo-lyase (Protein is coded in complementary strand; from 988829 to 987384)