Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 936306
End position: 936329
Length: 24

DNA sequence
>NC_010364, from 936306 to 936329 (24 bp); Halobacterium salinarum R1 GCCGCCGCAGCCGGCGCCGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 935732-936475	Sequence	OE2798R - phosphoesterase (Protein is coded in complementary strand; from 936475 to 935732)