Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 843562
End position: 843585
Length: 24

DNA sequence
>NC_010364, from 843562 to 843585 (24 bp); Halobacterium salinarum R1 CGGCGTCGCCGTCGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 843015-843797	Sequence	OE2613R - diphthine synthase (Protein is coded in complementary strand; from 843797 to 843015)