Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 837434
End position: 837457
Length: 24

DNA sequence
>NC_010364, from 837434 to 837457 (24 bp); Halobacterium salinarum R1 CGTCGTCGTCGTCGTCATCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 837394-838452	Sequence	OE2601R rplP0 acidic ribosomal protein P0 (Protein is coded in complementary strand; from 838452 to 837394)