Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 837140
End position: 837163
Length: 24

DNA sequence
>NC_010364, from 837140 to 837163 (24 bp); Halobacterium salinarum R1 TCGTCGTCGTCGCCGTCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 837044-837388	Sequence	OE2600R rpl12p 50S ribosomal protein L12 (Protein is coded in complementary strand; from 837388 to 837044)