Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 836024
End position: 836050
Length: 27

DNA sequence
>NC_010364, from 836024 to 836050 (27 bp); Halobacterium salinarum R1 ATCGCGAACAGCGCGAACAACGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 835679-836923	Sequence	OE2597R - hypothetical protein (Protein is coded in complementary strand; from 836923 to 835679)