Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 828668
End position: 828691
Length: 24

DNA sequence
>NC_010364, from 828668 to 828691 (24 bp); Halobacterium salinarum R1 CGTCGTCATCGTCGTCGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 828655-829755	Sequence	OE2583R - hypothetical protein (Protein is coded in complementary strand; from 829755 to 828655)