Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 803936
End position: 803959
Length: 24

DNA sequence
>NC_010364, from 803936 to 803959 (24 bp); Halobacterium salinarum R1 GCGTCAGCGTCTGTGTCAGCGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 803141-804481	Sequence	OE2540R - transposase (ISH6) (Protein is coded in complementary strand; from 804481 to 803141)