Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 789938
End position: 789961
Length: 24

DNA sequence
>NC_010364, from 789938 to 789961 (24 bp); Halobacterium salinarum R1 ACGTCCGCGTCCACGTCGACGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 788762-790042	Sequence	OE2524R ugd1 UDP-glucose 6-dehydrogenase (Protein is coded in complementary strand; from 790042 to 788762)