Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 718930
End position: 718965
Length: 36

DNA sequence
>NC_010364, from 718930 to 718965 (36 bp); Halobacterium salinarum R1 CGAACTCGTCGTCGAAGTCGTCATCGAAGTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 717606-719120	Sequence	OE2386R flaCE fla cluster protein flaCE (Protein is coded in complementary strand; from 719120 to 717606)