Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 371915
End position: 371941
Length: 27

DNA sequence
>NC_010364, from 371915 to 371941 (27 bp); Halobacterium salinarum R1 CCATGCCGCCCATGCCACCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 371830-373719	Sequence	OE1737R dnaK molecular chaperone DnaK (Protein is coded in complementary strand; from 373719 to 371830)