Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 349982
End position: 350005
Length: 24

DNA sequence
>NC_010364, from 349982 to 350005 (24 bp); Halobacterium salinarum R1 GACGACGGCGACGAGGACGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 349665-350516	Sequence	OE1695R - ABC-type transport system permease protein (Protein is coded in complementary strand; from 350516 to 349665)