Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 311811
End position: 311846
Length: 36

DNA sequence
>NC_010364, from 311811 to 311846 (36 bp); Halobacterium salinarum R1 CGTCCGCGGTCGCCTCCGCGATCGCGTCCGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 310574-313021	Sequence	OE1615R folCP folylpolyglutamate synthase / 7,8-dihydropteroate reductase / dihydropteroate synthase (Protein is coded in complementary strand; from 313021 to 310574)