Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 258767
End position: 258796
Length: 30

DNA sequence
>NC_010364, from 258767 to 258796 (30 bp); Halobacterium salinarum R1 CGTCGTCGGCGTCCTCGTCGTCGTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 258193-259053	Sequence	OE1512R scpA segregation and condensation protein scpA (Protein is coded in complementary strand; from 259053 to 258193)