Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1943627
End position: 1943650
Length: 24

DNA sequence
>NC_010364, from 1943627 to 1943650 (24 bp); Halobacterium salinarum R1 GTCGGTGTCGCTGTCGGGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1943391-1945250	Sequence	OE4671R - ATPase (Protein is coded in complementary strand; from 1945250 to 1943391)