Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1703793
End position: 1703816
Length: 24

DNA sequence
>NC_010364, from 1703793 to 1703816 (24 bp); Halobacterium salinarum R1 CGACCACGACCTCGACGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1703087-1703971	Sequence	OE4227F txrB3 oxidoreductase ( thioredoxin-disulfide reductase)