Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 170131
End position: 170154
Length: 24

DNA sequence
>NC_010364, from 170131 to 170154 (24 bp); Halobacterium salinarum R1 CGCCACCGCCACCACCACCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 169883-170551	Sequence	OE1332R - hypothetical protein (Protein is coded in complementary strand; from 170551 to 169883)