Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1690617
End position: 1690640
Length: 24

DNA sequence
>NC_010364, from 1690617 to 1690640 (24 bp); Halobacterium salinarum R1 CGAAGTCGAGGTCGACGTCGAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1690259-1690648	Sequence	OE4199R hisI phosphoribosyl-AMP cyclohydrolase (Protein is coded in complementary strand; from 1690648 to 1690259)