Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1644319
End position: 1644354
Length: 36

DNA sequence
>NC_010364, from 1644319 to 1644354 (36 bp); Halobacterium salinarum R1 GCCGCCCATGCCACCCATACCGCCCATGCCGCCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1644311-1645999	Sequence	OE4122R ths1 thermosome subunit 1 (Protein is coded in complementary strand; from 1645999 to 1644311)