Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1629517
End position: 1629540
Length: 24

DNA sequence
>NC_010364, from 1629517 to 1629540 (24 bp); Halobacterium salinarum R1 CCGCGAACGCGACCGTGACCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1629468-1631807	Sequence	OE4105R brr2 ATP-dependent DNA helicase (Protein is coded in complementary strand; from 1631807 to 1629468)