Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1559800
End position: 1559823
Length: 24

DNA sequence
>NC_010364, from 1559800 to 1559823 (24 bp); Halobacterium salinarum R1 CAGACGCAGAAGTAGACGCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1559518-1560540	Sequence	OE3980R blh brp-like protein (Protein is coded in complementary strand; from 1560540 to 1559518)