Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1528088
End position: 1528123
Length: 36

DNA sequence
>NC_010364, from 1528088 to 1528123 (36 bp); Halobacterium salinarum R1 GCCGCCCATGCCACCGCCCATACCGCCGCCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1528080-1529750	Sequence	OE3925R ths2 thermosome subunit 2 (Protein is coded in complementary strand; from 1529750 to 1528080)