Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1344867
End position: 1344890
Length: 24

DNA sequence
>NC_010364, from 1344867 to 1344890 (24 bp); Halobacterium salinarum R1 TCGACGTCGAGGTCGTCGTCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1343352-1345274	Sequence	OE3580R thrS threonyl-tRNA synthetase (Protein is coded in complementary strand; from 1345274 to 1343352)