Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1309402
End position: 1309425
Length: 24

DNA sequence
>NC_010364, from 1309402 to 1309425 (24 bp); Halobacterium salinarum R1 GTCGGCGTCGGCGACGGCGTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1309241-1310461	Sequence	OE3509R - DNA primase (Protein is coded in complementary strand; from 1310461 to 1309241)