Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1294738
End position: 1294761
Length: 24

DNA sequence
>NC_010364, from 1294738 to 1294761 (24 bp); Halobacterium salinarum R1 GCGTCGGCGGCGGCTTCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1294123-1296417	Sequence	OE3481R htrII transducer protein htrII (Protein is coded in complementary strand; from 1296417 to 1294123)