Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1195067
End position: 1195093
Length: 27

DNA sequence
>NC_010364, from 1195067 to 1195093 (27 bp); Halobacterium salinarum R1 GCGTCGCCGGCGTCGCGGTCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1194674-1195258	Sequence	OE3297R msuE NADH-dependent FMN reductase (Protein is coded in complementary strand; from 1195258 to 1194674)