Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1138315
End position: 1138350
Length: 36

DNA sequence
>NC_010364, from 1138315 to 1138350 (36 bp); Halobacterium salinarum R1 CGTGCTCGACGGCGAGATCGACGGCGTGCGCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1137966-1138409	Sequence	OE3187R - UpsA domain-containing protein (Protein is coded in complementary strand; from 1138409 to 1137966)