Sequence retrieval

Genome: Halobacterium salinarum R1
Start position: 1093330
End position: 1093353
Length: 24

DNA sequence
>NC_010364, from 1093330 to 1093353 (24 bp); Halobacterium salinarum R1 CGTCGTCGACGTCGTCGGCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1093323-1094147	Sequence	OE3119R panB 3-methyl-2-oxobutanoate hydroxymethyltransferase (Protein is coded in complementary strand; from 1094147 to 1093323)