Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4696207
End position: 4696260
Length: 54

DNA sequence
>NC_010322, from 4696207 to 4696260 (54 bp); Pseudomonas putida GB-1 CTCGGCAGCCTTCTTCGCCTCGTCGGCCTTCTTGGCTTCGGCAGCTTTCTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4695548-4696666	Sequence	PputGB1_4197 - protein TolA (Protein is coded in complementary strand; from 4696666 to 4695548)