Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1664745
End position: 1664798
Length: 54

DNA sequence
>NC_010322, from 1664745 to 1664798 (54 bp); Pseudomonas putida GB-1 CGAGGTGCGCGCTCTTCACGTGGAGCACGCTCTTCACGCGGTGCACGCTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1663680-1666940	Sequence	PputGB1_1481 - ribonuclease (Protein is coded in complementary strand; from 1666940 to 1663680)