Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4629651
End position: 4629698
Length: 48

DNA sequence
>NC_010322, from 4629651 to 4629698 (48 bp); Pseudomonas putida GB-1 GGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4628151-4630064	Sequence	PputGB1_4145 - hypothetical protein (Protein is coded in complementary strand; from 4630064 to 4628151)